AAVS1-TRE-U2AF2-TurboID-HA-rtTA
(Plasmid
#226997)
-
PurposeIntegrative plasmid to express U2AF2-TurboID in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 226997 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAVS1-TRE-TurboID-HA-rtTA
- Backbone size w/o insert (bp) 11031
- Total vector size (bp) 12440
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU2 small nuclear RNA auxiliary factor 2
-
Alt nameU2AF2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1425
-
Entrez GeneU2AF2 (a.k.a. DEVDFB, U2AF65)
-
Tag
/ Fusion Protein
- TurboID-HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site BstBI (not destroyed)
- 5′ sequencing primer CACGTCTCGAGCTCCCTATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: This plasmid contains a D404V mutation in U2AF65. This mutation is not expected to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-TRE-U2AF2-TurboID-HA-rtTA was a gift from Bruno Dallagiovanna (Addgene plasmid # 226997 ; http://n2t.net/addgene:226997 ; RRID:Addgene_226997) -
For your References section:
Construction of a proximity labeling vector to identify protein-protein interactions in human stem cells. Gomes-Junior R, Moreira CMDN, Dallagiovanna B. PLoS One. 2025 May 30;20(5):e0324779. doi: 10.1371/journal.pone.0324779. eCollection 2025. 10.1371/journal.pone.0324779 PubMed 40445938