AAVS1-TRE-GFP-TurboID-HA-rtTA
(Plasmid
#226996)
-
PurposeIntegrative plasmid to express GFP-TurboID in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 226996 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAVS1-TRE-TurboID-HA-rtTA
- Backbone size w/o insert (bp) 11031
- Total vector size (bp) 11735
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGreen fluorescent protein
-
Alt nameGFP
-
SpeciesSynthetic
-
Insert Size (bp)717
-
Entrez Genegfp (a.k.a. pCmGFP_001)
-
Tag
/ Fusion Protein
- TurboID-HA (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site BstBI (not destroyed)
- 5′ sequencing primer CACGTCTCGAGCTCCCTATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-TRE-GFP-TurboID-HA-rtTA was a gift from Bruno Dallagiovanna (Addgene plasmid # 226996 ; http://n2t.net/addgene:226996 ; RRID:Addgene_226996)