pBABE-puro-mIR-31 sponge
(Plasmid #22694)

• Purpose: Stable suppression of miR-31 function
• Depositing Lab: Bob Weinberg
• Publication: Valastyan et al Cell. 2009 Jun 12. 137(6):1032-46.

Backbone

• Vector backbone: pBABE-puro
• Backbone manufacturer: Weinberg lab (Addgene#:1764)
• Backbone size w/o insert (bp): 5169
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: miR-31
• Alt name: stable miR-31 sponge
• Species: H. sapiens (human)
• Insert Size (bp): 1100
• Mutation: miR-31 sponge with 7x tandem binding sites to the microRNA.
• Entrez Gene: MIR31 (a.k.a. MIRN31, hsa-mir-31, miR-31)
• Tag / Fusion Protein:
  • * (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: ApaI (not destroyed)
• 5′ sequencing primer: pBabe-5
• 3′ sequencing primer: pBabe-3

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Useful for stable suppression of miR-31 function.

Original sponge backbone modifed from Ebert et al., Nat. Methods (2007); miR-31 construct and stable design are novel

Repeated sequence is: AGGCAAGACGAGGCATAGCT

*Addgene sequencing found at least partial EGFP upstream of the sponge. We do not know if the EGFP is functional or a side-product of the cloning.