pAAV-MYL2-TadA8e-SpN aa2-713- inteinN-U6-Camk2d sgRNA7
(Plasmid
#226915)
-
PurposeExpresses TadA8e and Sp cas9N by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 226915 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-CMV-TadA8e-SpG N aa2-713-InteinN
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMYL2, TadA, nSp Cas9N, inteinN
-
gRNA/shRNA sequenceacttAccaaaccatgcctgc
- Promoter MYL2
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gctctaggaagatcggaatt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-MYL2-TadA8e-SpN aa2-713- inteinN-U6-Camk2d sgRNA7 was a gift from Yuxuan Guo (Addgene plasmid # 226915 ; http://n2t.net/addgene:226915 ; RRID:Addgene_226915) -
For your References section:
ABE-Mediated Cardiac Gene Silencing via Single AAVs Requires DNA Accessibility. Liu Z, Yang L, Yang Y, Li J, Chen Z, Guo C, Guo Q, Li Q, Zhao D, Hu X, Gao F, Guo Y. Circ Res. 2025 Jan 16. doi: 10.1161/CIRCRESAHA.124.325611. 10.1161/CIRCRESAHA.124.325611 PubMed 39817340