pET-NPR4 (SA binding domain)
(Plasmid
#226885)
-
PurposeExpresses the Salicylic acid binding core (SBC) of NPR4 in E.coli, in an insoluble form
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 226885 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET
- Backbone size w/o insert (bp) 5752
- Total vector size (bp) 6166
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameThe Salicylic acid (SA) binding domain of NPR4
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)414
-
MutationNPR4 SA-binding core (residues 373-516), with a short internal deletion of residues 450-455.
-
GenBank IDNM_118086.3
-
Entrez GeneNPR4 (a.k.a. AT4G19660, ATNPR4, NPR1-like protein 4, T16H5.20, T16H5_20)
- Promoter T7
-
Tag
/ Fusion Protein
- His tag (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cagcagccatcatcatcatc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-NPR4 (SA binding domain) was a gift from Ning Zheng (Addgene plasmid # 226885 ; http://n2t.net/addgene:226885 ; RRID:Addgene_226885) -
For your References section:
Structural basis of salicylic acid perception by Arabidopsis NPR proteins. Wang W, Withers J, Li H, Zwack PJ, Rusnac DV, Shi H, Liu L, Yan S, Hinds TR, Guttman M, Dong X, Zheng N. Nature. 2020 Oct;586(7828):311-316. doi: 10.1038/s41586-020-2596-y. Epub 2020 Aug 12. 10.1038/s41586-020-2596-y PubMed 32788727