pFB-Dual-MBP-NavAb (KAV/G94C/Q150C)
(Plasmid
#226884)
-
PurposeExpresses a mutant of the Arcobacter butzleri voltage-gated sodium channel fused to an MBP tag in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 226884 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFastBac Dual
-
Backbone manufacturerThermo Fisher (Invitrogen)
- Backbone size w/o insert (bp) 5238
- Total vector size (bp) 7119
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNaVAb
-
SpeciesAliarcobacter butzleri (strain RM4018)
-
Insert Size (bp)1914
-
MutationR4A, N49K, L109A, M116V
-
GenBank IDABV67998.1
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- MBP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CGCGCGGAATTCATGAAAATCGAAGAAGGTAAACTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB-Dual-MBP-NavAb (KAV/G94C/Q150C) was a gift from Ning Zheng (Addgene plasmid # 226884 ; http://n2t.net/addgene:226884 ; RRID:Addgene_226884) -
For your References section:
Resting-State Structure and Gating Mechanism of a Voltage-Gated Sodium Channel. Wisedchaisri G, Tonggu L, McCord E, Gamal El-Din TM, Wang L, Zheng N, Catterall WA. Cell. 2019 Aug 8;178(4):993-1003.e12. doi: 10.1016/j.cell.2019.06.031. Epub 2019 Jul 25. 10.1016/j.cell.2019.06.031 PubMed 31353218