Skip to main content
Addgene

pAHW/Joseph2-Multitagged Plasmid
(Plasmid #226725)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 226725 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAHW
  • Backbone manufacturer
    Drosophila Genomics Resource Center
  • Vector type
    Insect Expression ; Drosophila S2 cell expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pAHW/Joseph2
  • Promoter Act5C
  • Tag / Fusion Protein
    • HA, Myc, GFP, Flag, V5, 6xHis

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer GTTCAGGGGGAGGTGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAHW/Joseph2-Multitagged Plasmid was a gift from Richard Cripps (Addgene plasmid # 226725 ; http://n2t.net/addgene:226725 ; RRID:Addgene_226725)
  • For your References section:

    pJoseph2: a family of plasmids as positive controls for bacterial protein expression, transfections, and western blots. Robinson E, Alonso EB, A Waters J, Bileckyj C, D House C, A Johnston C, M Cripps R. Biotechniques. 2024;76(7):299-309. doi: 10.1080/07366205.2024.2343609. Epub 2024 May 12. 10.1080/07366205.2024.2343609 PubMed 39185782