Skip to main content
Addgene

pEXP1/Joseph2-Multitagged Plasmid
(Plasmid #226724)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 226724 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEXP1
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pEXP1/Joseph2
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis, HA, Myc, GFP, Flag, V5

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEXP1/Joseph2-Multitagged Plasmid was a gift from Richard Cripps (Addgene plasmid # 226724 ; http://n2t.net/addgene:226724 ; RRID:Addgene_226724)

  • For your References section:

    pJoseph2: a family of plasmids as positive controls for bacterial protein expression, transfections, and western blots. Robinson E, Alonso EB, A Waters J, Bileckyj C, D House C, A Johnston C, M Cripps R. Biotechniques. 2024;76(7):299-309. doi: 10.1080/07366205.2024.2343609. Epub 2024 May 12. 10.1080/07366205.2024.2343609 PubMed 39185782
Related items: