pTBL3331 MTK234-TetO-AtoBpegRNA
(Plasmid
#226668)
-
PurposeMTK234 part containing tet-inducible variant of the hU6 promoter driving an A to B pegRNA
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 226668 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneMTK234
-
Backbone manufacturerHana El-Samad Lab
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehU6-TetO-AtoBpegRNA
-
gRNA/shRNA sequenceGCCATCATCACCATCATTGA
-
SpeciesSynthetic
- Promoter hU6-TetO
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ColE1 (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byHana El-Samad (Mammalian Toolkit, Kit #1000000180).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2021.11.05.467507 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTBL3331 MTK234-TetO-AtoBpegRNA was a gift from Chang Liu (Addgene plasmid # 226668 ; http://n2t.net/addgene:226668 ; RRID:Addgene_226668) -
For your References section:
Open-ended molecular recording of sequential cellular events into DNA. Loveless BT, Carlson CK, Dentzel Helmy CA, Hu VJ, Ross SK, Demelo MC, Murtaza A, Liang G, Ficht M, Singhai A, Pajoh-Casco MJ, Liu CC. bioRxiv 2021.11.05.467507 10.1101/2021.11.05.467507