pCKC776
(Plasmid #226627)

• Purpose: piggyBAC 4xHRE YB_TATA hCas9-T2A-G/C-biased1
• Depositing Lab: Chang Liu
• Publication: Carlson et al bioRxiv [Preprint]. 2024 Jun 11:2024.06.11.598561. doi: 10.1101/2024.06.11.598561.

Backbone

• Vector backbone: MTK0_002 piggyBAC destination vector (Addgene plasmid #123960)
• Backbone size w/o insert (bp): 2502
• Vector type: Mammalian Expression, Synthetic Biology
• Selectable markers: sfGFP

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: 4x HRE_YB TATA, SpCas9, oxygen-dependent degron, T2A, G/C-biased1 variant of TdT
• Species: H. sapiens (human); S. pyogenes
• Insert Size (bp): 6653
• Entrez Gene: DNTT (a.k.a. TDT)
• Promoter: 4xHRE_YB TATA
• Tag / Fusion Protein:
  • oxygen dependent degron (ODD)

Cloning Information for Gene/Insert 1

• Cloning method: Golden Gate
• 5′ sequencing primer: agaatgctagcatgggcccagatc

Gene/Insert 2

• Gene/Insert name: EF1a promoter, mCherry
• Promoter: EF1a

Cloning Information for Gene/Insert 2

• Cloning method: Golden Gate
• 5′ sequencing primer: gaaggaaaggttgcatgctggacac

Resource Information

• Supplemental Documents:
  • pckc776__confirm.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid has also been grown in Invitrogen TOP10 chemically competent E. coli.

Please visit https://doi.org/10.1101/2024.06.11.598561 for bioRxiv preprint.