pFB-GST-IRP2
(Plasmid
#226621)
-
PurposeExpresses human IRP2 in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 226621 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFastBAC
- Backbone size w/o insert (bp) 5739
- Total vector size (bp) 8634
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIRP2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2892
-
GenBank IDNM_004136.4
-
Entrez GeneIREB2 (a.k.a. ACO3, IRE-BP 2, IRE-BP2, IRP2, IRP2AD, NDCAMA)
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- GST (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gggctggcaagccacgtttggtg
- 3′ sequencing primer caaatgtggtatggctgatt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB-GST-IRP2 was a gift from Ning Zheng (Addgene plasmid # 226621 ; http://n2t.net/addgene:226621 ; RRID:Addgene_226621) -
For your References section:
FBXL5 Regulates IRP2 Stability in Iron Homeostasis via an Oxygen-Responsive [2Fe2S] Cluster. Wang H, Shi H, Rajan M, Canarie ER, Hong S, Simoneschi D, Pagano M, Bush MF, Stoll S, Leibold EA, Zheng N. Mol Cell. 2020 Apr 2;78(1):31-41.e5. doi: 10.1016/j.molcel.2020.02.011. Epub 2020 Mar 2. 10.1016/j.molcel.2020.02.011 PubMed 32126207