Skip to main content
Addgene

pCDHblast MCSNard OST-LMNAd50
(Plasmid #22662)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 22662 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCDHblast
  • Backbone size w/o insert (bp) 7000
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LaminAd50 (=Progerin)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2000
  • Mutation
    50AA deletion creating Progerin instead of mature LMNA
  • Tag / Fusion Protein
    • Onestrep Tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI, XhoI, NotI, SwaI, BglII, AsuII (not destroyed)
  • 5′ sequencing primer AAATGGGCGGTAGGCGTGT
  • 3′ sequencing primer TCTCTAGGCACCCGTTCAAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDHblast MCSNard OST-LMNAd50 was a gift from Tom Misteli (Addgene plasmid # 22662 ; http://n2t.net/addgene:22662 ; RRID:Addgene_22662)
  • For your References section:

    Ageing-related chromatin defects through loss of the NURD complex. Pegoraro G, Kubben N, Wickert U, Göhler H, Hoffmann K, Misteli T. Nat Cell Biol. 2009 Oct . 11(10):1261-7. 10.1038/ncb1971 PubMed 19734887