pCDHblast MCSNard OST-LMNAd50
(Plasmid #22662)

• Depositing Lab: Tom Misteli
• Publication: Pegoraro et al Nat Cell Biol. 2009 Oct . 11(10):1261-7.

Backbone

• Vector backbone: pCDHblast
• Backbone size w/o insert (bp): 7000
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LaminAd50 (=Progerin)
• Species: H. sapiens (human)
• Insert Size (bp): 2000
• Mutation: 50AA deletion creating Progerin instead of mature LMNA
• Tag / Fusion Protein:
  • Onestrep Tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI, XhoI, NotI, SwaI, BglII, AsuII (not destroyed)
• 5′ sequencing primer: AAATGGGCGGTAGGCGTGT
• 3′ sequencing primer: TCTCTAGGCACCCGTTCAAT

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry