Skip to main content
Addgene

pFB-D3-ASK1
(Plasmid #226619)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 226619 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pFastBAC
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 9231
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    D3
  • Species
    O. sativa
  • Mutation
    The flexible loop in D3 (Q478-D515) can be removed by TEV
  • GenBank ID
    NM_001424596.1
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • His tag followed with three copies of Msyb (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ggattattcataccgtccca
  • 3′ sequencing primer caaatgtggtatggctgatt
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    ASK1
  • Species
    A. thaliana (mustard weed)
  • Entrez Gene
    SKP1 (a.k.a. AT1G75950, ARABIDOPSIS SKP1 HOMOLOGUE 1, ASK1, ATSKP1, S phase kinase-associated protein 1, SKP1A, T4O12.17, T4O12_17, UFO INTERACTING PROTEIN 1, UIP1)
  • Promoter Polyhedrin

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ggattattcataccgtccca
  • 3′ sequencing primer caaatgtggtatggctgatt
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFB-D3-ASK1 was a gift from Ning Zheng (Addgene plasmid # 226619 ; http://n2t.net/addgene:226619 ; RRID:Addgene_226619)

  • For your References section:

    Structural plasticity of D3-D14 ubiquitin ligase in strigolactone signalling. Shabek N, Ticchiarelli F, Mao H, Hinds TR, Leyser O, Zheng N. Nature. 2018 Nov;563(7733):652-656. doi: 10.1038/s41586-018-0743-5. Epub 2018 Nov 21. 10.1038/s41586-018-0743-5 PubMed 30464344
Related items: