pSecTaq2-hGas6-Myc-6xHis
(Plasmid
#226523)
-
PurposeExpresses TAM Receptor Ligand human GAS6
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 226523 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSecTag2
-
Backbone manufacturerThermoFisher Scientific
- Backbone size w/o insert (bp) 5527
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman GAS6
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1944
-
Entrez GeneGAS6 (a.k.a. AXLLG, AXSF)
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGTTCCACTGGTGACAACTTTCTTAGTAAA
- 3′ sequencing primer TCCTCGAGCGGCCGCAGAATTTTTCGTTTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSecTaq2-hGas6-Myc-6xHis was a gift from Raymond Birge & Sergei Kotenko (Addgene plasmid # 226523 ; http://n2t.net/addgene:226523 ; RRID:Addgene_226523) -
For your References section:
Requirement of Gamma-Carboxyglutamic Acid Modification and Phosphatidylserine Binding for the Activation of Tyro3, Axl, and Mertk Receptors by Growth Arrest-Specific 6. Geng K, Kumar S, Kimani SG, Kholodovych V, Kasikara C, Mizuno K, Sandiford O, Rameshwar P, Kotenko SV, Birge RB. Front Immunol. 2017 Nov 10;8:1521. doi: 10.3389/fimmu.2017.01521. eCollection 2017. 10.3389/fimmu.2017.01521 PubMed 29176978