Skip to main content
Addgene

AMPK(T>A)-SPARK
(Plasmid #226256)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 226256 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pTwist CMV
  • Backbone manufacturer
    Twist Biosciences
  • Backbone size w/o insert (bp) 4207
  • Total vector size (bp) 5965
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AMPK(T>A)-SPARK
  • Alt name
    phospho-null mutant version of AMPK-SPARK
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1758
  • Mutation
    substituted Threonine 20 with Alanine

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer TTTGTCGATCCTACCATCCACTC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AMPK(T>A)-SPARK was a gift from Roland Malli (Addgene plasmid # 226256 ; http://n2t.net/addgene:226256 ; RRID:Addgene_226256)

  • For your References section:

    Development of a Dual Reporter System to Simultaneously Visualize Ca(2+) Signals and AMPK Activity. Erdogan YC, Pilic J, Gottschalk B, Yigit EN, Zaki AG, Ozturk G, Eroglu E, Okutan B, Sommer NG, Weinberg AM, Schindl R, Graier WF, Malli R. ACS Sens. 2024 Aug 21. doi: 10.1021/acssensors.4c01058. 10.1021/acssensors.4c01058 PubMed 39167044
Related items:
Commonly requested with: