pENTR/hBIG1
(Plasmid #226251)

• Purpose: Entry plasmid of hBIG1 for Gateway system
• Depositing Lab: Hye-Won Shin
• Publication: Mammalian expression plasmids and entry plasmids for Gateway (unpublished)

Backbone

• Vector backbone: pENTR3C
• Vector type: Entry Vector

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: BIG1
• Species: H. sapiens (human)
• Entrez Gene: ARFGEF1 (a.k.a. ARFGEP1, BIG1, DEDISB, P200)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: gttagttacttaagctcgggc
• 3′ sequencing primer: gattttgagacacgggccag

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

How to amplify BIG1 and BIG2 plasmids:
1. Plasmids containing BIG1 and BIG2 appear to be detrimental to bacterial growth. After transformation, an extended incubation time is required to obtain colonies in comparison to usual transformed bacteria. Additionally, the colonies are smaller than usual ones. Therefore, take small colonies for liquid culture. (We were usually using DH5a for transformation.)
2. Mini-prep: For 3~5 mL liquid culture from a single colony, use very fresh colonies; otherwise plasmid yields may be significantly reduced.
3. Maxi-prep (Large scale prep): Do not make a preculture from a single colony for large scale culture. I recommend directly inoculating all transformed bacteria into the large scale culture (200 mL ~ of ampicillin containing medium), after transformation and recovery culture. This helps a lot to get enough plasmids.