pEF2-FL-hTyro_gR1
(Plasmid
#225995)
-
PurposeExpresses a chimeric contruct having N-terminal human Tyro3 and C-terminal human Interferon Gamma Receptor
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 225995 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEF2
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ttcttccatttcaggtgtcg
- 3′ sequencing primer gtcgaggctgatcagcgagc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF2-FL-hTyro_gR1 was a gift from Raymond Birge & Sergei Kotenko (Addgene plasmid # 225995 ; http://n2t.net/addgene:225995 ; RRID:Addgene_225995) -
For your References section:
Receptor tyrosine kinases, TYRO3, AXL, and MER, demonstrate distinct patterns and complex regulation of ligand-induced activation. Tsou WI, Nguyen KQ, Calarese DA, Garforth SJ, Antes AL, Smirnov SV, Almo SC, Birge RB, Kotenko SV. J Biol Chem. 2014 Sep 12;289(37):25750-63. doi: 10.1074/jbc.M114.569020. Epub 2014 Jul 29. 10.1074/jbc.M114.569020 PubMed 25074926