Skip to main content
Addgene

pEF2-FL-hMer_gR1
(Plasmid #225993)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225993 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEF2
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human MerTK N-Terminal human Interferon Gamma R1 Receptor C-Terminal fusion
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2271
  • Entrez Gene
    MERTK (a.k.a. MER, RP38, Tyro12, c-Eyk, c-mer)
  • Entrez Gene
    IFNGR1 (a.k.a. CD119, IFNGR, IMD27A, IMD27B)
  • Promoter EF1-a

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ttcttccatttcaggtgtcg
  • 3′ sequencing primer gtcgaggctgatcagcgagc
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEF2-FL-hMer_gR1 was a gift from Raymond Birge & Sergei Kotenko (Addgene plasmid # 225993 ; http://n2t.net/addgene:225993 ; RRID:Addgene_225993)

  • For your References section:

    Receptor tyrosine kinases, TYRO3, AXL, and MER, demonstrate distinct patterns and complex regulation of ligand-induced activation. Tsou WI, Nguyen KQ, Calarese DA, Garforth SJ, Antes AL, Smirnov SV, Almo SC, Birge RB, Kotenko SV. J Biol Chem. 2014 Sep 12;289(37):25750-63. doi: 10.1074/jbc.M114.569020. Epub 2014 Jul 29. 10.1074/jbc.M114.569020 PubMed 25074926
Related items: