Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Flag-HA-USP43
(Plasmid #22583)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 22583 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDEST_LTR_N_FLAG_HA_IRES_puro
  • Backbone manufacturer
    Harper_Lab
  • Backbone size w/o insert (bp) 6521
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    USP43
  • Alt name
    ubiquitin specific peptidase 43
  • Alt name
    FLJ30626
  • Species
    H. sapiens (human)
  • Mutation
    not FL, missing first 108 aa
  • GenBank ID
    NM_153210
  • Entrez Gene
    USP43
  • Tags / Fusion Proteins
    • HA (N terminal on backbone)
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ cloning site GATEWAY_LR (unknown if destroyed)
  • 3′ cloning site GATEWAY_LR (unknown if destroyed)
  • 5′ sequencing primer CAGCCCTCACTCCTTCTCTAGG
  • 3′ sequencing primer CAAGCGGCTTCGGCCAGTAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Flag-HA-USP43 was a gift from Wade Harper (Addgene plasmid # 22583 ; http://n2t.net/addgene:22583 ; RRID:Addgene_22583)
  • For your References section:

    Defining the human deubiquitinating enzyme interaction landscape. Sowa ME, Bennett EJ, Gygi SP, Harper JW. Cell. 2009 Jul 23. 138(2):389-403. 10.1016/j.cell.2009.04.042 PubMed 19615732