-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 22580 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDEST_LTR_N_FLAG_HA_IRES_puro
-
Backbone manufacturerHarper_Lab
- Backbone size w/o insert (bp) 6521
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUSP38
-
Alt nameubiquitin specific peptidase 38
-
Alt nameFLJ35970, HP43.8KD, KIAA1891
-
SpeciesH. sapiens (human)
-
MutationNone
-
GenBank IDBC068975.1
-
Entrez GeneUSP38 (a.k.a. HP43.8KD)
-
Tags
/ Fusion Proteins
- HA (N terminal on backbone)
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ cloning site GATEWAY_LR (unknown if destroyed)
- 3′ cloning site GATEWAY_LR (unknown if destroyed)
- 5′ sequencing primer CAGCCCTCACTCCTTCTCTAGG
- 3′ sequencing primer CAAGCGGCTTCGGCCAGTAAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMarc_Vidal_Orfeome_collection
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Flag-HA-USP38 was a gift from Wade Harper (Addgene plasmid # 22580 ; http://n2t.net/addgene:22580 ; RRID:Addgene_22580) -
For your References section:
Defining the human deubiquitinating enzyme interaction landscape. Sowa ME, Bennett EJ, Gygi SP, Harper JW. Cell. 2009 Jul 23. 138(2):389-403. 10.1016/j.cell.2009.04.042 PubMed 19615732