CROPseq-multi-v2-SpCas9-P2A-Puro-BsmBI_entry (pRW1512)
(Plasmid
#225756)
-
Purpose(Empty Backbone) Entry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with expression of SpCas9 and Puromycin resistance; v2 is compatible with T7 in vitro transcription detection
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225756 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneCROPseq-multi-Puro (pRW1441)
-
Modifications to backbonea T7 promoter is encoded within the 3' LTR
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GGGCTAATTCACTCCCAACGAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2024.03.17.585235 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CROPseq-multi-v2-SpCas9-P2A-Puro-BsmBI_entry (pRW1512) was a gift from Paul Blainey (Addgene plasmid # 225756 ; http://n2t.net/addgene:225756 ; RRID:Addgene_225756) -
For your References section:
CROPseq-multi: a versatile solution for multiplexed perturbation and decoding in pooled CRISPR screens. Walton RT, Qin Y, Blainey PC. bioRxiv 2024.03.17.585235 10.1101/2024.03.17.585235
