Skip to main content
Addgene

pAAV-hsyn-ASAP5-WPRE
(Plasmid #225709)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225709 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ASAP5
  • Insert Size (bp)
    1275
  • Promoter human synapsin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gcagtcgagaaggtaccggatccgccaccatggagacgactgtgaggtatgaac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hsyn-ASAP5-WPRE was a gift from Michael Lin (Addgene plasmid # 225709 ; http://n2t.net/addgene:225709 ; RRID:Addgene_225709)
  • For your References section:

    A fast and responsive voltage indicator with enhanced sensitivity for unitary synaptic events. Hao YA, Lee S, Roth RH, Natale S, Gomez L, Taxidis J, O'Neill PS, Villette V, Bradley J, Wang Z, Jiang D, Zhang G, Sheng M, Lu D, Boyden E, Delvendahl I, Golshani P, Wernig M, Feldman DE, Ji N, Ding J, Sudhof TC, Clandinin TR, Lin MZ. Neuron. 2024 Sep 17:S0896-6273(24)00643-3. doi: 10.1016/j.neuron.2024.08.019. 10.1016/j.neuron.2024.08.019 PubMed 39305894