pAAV-hsyn-ASAP5-WPRE
(Plasmid
#225709)
-
PurposeCre-dependent pan-membrane expression of the genetically encoded voltage indicator ASAP5, can be used for dendritic voltage imaging
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 225709 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameASAP5
-
Insert Size (bp)1275
- Promoter human synapsin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gcagtcgagaaggtaccggatccgccaccatggagacgactgtgaggtatgaac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hsyn-ASAP5-WPRE was a gift from Michael Lin (Addgene plasmid # 225709 ; http://n2t.net/addgene:225709 ; RRID:Addgene_225709) -
For your References section:
A fast and responsive voltage indicator with enhanced sensitivity for unitary synaptic events. Hao YA, Lee S, Roth RH, Natale S, Gomez L, Taxidis J, O'Neill PS, Villette V, Bradley J, Wang Z, Jiang D, Zhang G, Sheng M, Lu D, Boyden E, Delvendahl I, Golshani P, Wernig M, Feldman DE, Ji N, Ding J, Sudhof TC, Clandinin TR, Lin MZ. Neuron. 2024 Sep 17:S0896-6273(24)00643-3. doi: 10.1016/j.neuron.2024.08.019. 10.1016/j.neuron.2024.08.019 PubMed 39305894