pAJE-Ma pylRS nitroY/haloY-F5
(Plasmid #225684)

• Purpose: Expresses Methanomethylophilus alvus pyrrolysine tRNA synthetase engineered for 3-nitroY and 3-haloY under GlnS promoter. Used as a control during Ma Pyl tRNA-synthetase validation.
• Depositing Lab: Ryan Mehl
• Publication: Engineering of Aminoacyl-tRNA synthetase/tRNA pairs for efficient genetic encoding of non-canonical amino acids into proteins. (unpublished)

Backbone

• Vector backbone: pAJE-Ma
• Backbone size w/o insert (bp): 3219
• Total vector size (bp): 4044
• Vector type: Methanomethylophilus alvus

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: M. alvus PylRS 3-NY/HaloY F5
• Alt name: NYF5
• Species: Methanomethylophilus alvus
• Mutation: CTG125CTT, N166A, V168S, A223C, W239R
• Promoter: GlnS

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: tgctgagttgaaggatcctcgg
• 3′ sequencing primer: gtgaacgccttatccggcctac

Gene/Insert 2

• Gene/Insert name: M. alvus Pyl-tRNA(6)
• Species: Methanomethylophilus alvus
• Insert Size (bp): 75
• Promoter: Lpp

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI,BglII (unknown if destroyed)
• 3′ cloning site: SpeI,HindIII (unknown if destroyed)
• 5′ sequencing primer: TTCTGTTGCCCGTCTCACTGG

Resource Information

• Supplemental Documents:
  • pAJE-Ma pylRS nitroYhaloY-F5.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Expresses a) Methanomethylophilus alvus pyrrolysine tRNA synthetase (MaPylRS) engineered for 3-nitrotyrosine and 3-halotryosines under GlnS promoter and b) Methanomethylophilus alvus pyrrolysine tRNA under an Lpp promoter(6). Used as a control for Ma Pyl tRNA-synthetase validation for BL21 or similar cell lines. This plasmid expresses the MaRS and Pyl tRNA and must be paired with a plasmid containing a gene of interest with an amber codon for nitroTyr/haloTyr incorporation.