Flag-HA-STAMBPL1
(Plasmid #22559)

• Depositing Lab: Wade Harper
• Publication: Sowa et al Cell. 2009 Jul 23. 138(2):389-403.

Backbone

• Vector backbone: pDEST_LTR_N_FLAG_HA_IRES_puro
• Backbone manufacturer: Harper_Lab
• Backbone size w/o insert (bp): 6521
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: STAMBPL1
• Alt name: STAM binding protein-like 1
• Alt name: ALMalpha, AMSH-FP, AMSH-LP, FLJ31524, KIAA1373, bA399O19.2
• Species: H. sapiens (human)
• Mutation: None
• GenBank ID: CV026750
• Entrez Gene: STAMBPL1 (a.k.a. ALMalpha, AMSH-FP, AMSH-LP, bA399O19.2)
• Tags / Fusion Proteins:
  • HA (N terminal on backbone)
  • FLAG (N terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ cloning site: GATEWAY_LR (unknown if destroyed)
• 3′ cloning site: GATEWAY_LR (unknown if destroyed)
• 5′ sequencing primer: CAGCCCTCACTCCTTCTCTAGG
• 3′ sequencing primer: CAAGCGGCTTCGGCCAGTAAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: MGC/Open
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry