Skip to main content
Addgene

pLVUT-spGFP
(Plasmid #225486)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225486 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLVUT-tTR-KRAB
  • Backbone manufacturer
    Addgene Plasmid #11651, PIs Patrick Aebischer and Didier Trono
  • Backbone size w/o insert (bp) 11497
  • Total vector size (bp) 11664
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Igκ leader and TAT peptide
  • Alt name
    Ig kappa-TAT
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    167
  • Promoter Human ubiquitin C
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site NcoI (not destroyed)
  • 5′ sequencing primer tgaagctccggttttgaact
  • 3′ sequencing primer cgtcgccgtccagctcgaccag
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVUT-spGFP was a gift from Robert Gross (Addgene plasmid # 225486 ; http://n2t.net/addgene:225486 ; RRID:Addgene_225486)

  • For your References section:

    C3 transferase gene therapy for continuous conditional RhoA inhibition. Gutekunst CA, Tung JK, McDougal ME, Gross RE. Neuroscience. 2016 Dec 17;339:308-318. doi: 10.1016/j.neuroscience.2016.10.022. Epub 2016 Oct 13. 10.1016/j.neuroscience.2016.10.022 PubMed 27746349
Related items: