pcDNA3puro-mGFP-FMR1iso1-I304N
(Plasmid
#225463)
-
PurposeExpress mEGFP-fusion protein of FMR1 isoform 1 (I304N)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 225463 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3-puro
-
Backbone manufacturerMayr Lab
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFMR1 isoform 1
-
SpeciesH. sapiens (human)
-
MutationI304N
-
Entrez GeneFMR1 (a.k.a. FMRP, FRAXA, POF, POF1)
- Promoter CMV
-
Tag
/ Fusion Protein
- mEGFP (N terminal on insert)
Cloning Information
- Cloning method Other
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Resistant to shRNA TRCN0000059759 (target sequence GCGTTTGGAGAGATTACAAAT). Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3puro-mGFP-FMR1iso1-I304N was a gift from Christine Mayr (Addgene plasmid # 225463 ; http://n2t.net/addgene:225463 ; RRID:Addgene_225463) -
For your References section:
The FXR1 network acts as signaling scaffold for actomyosin remodeling. Chen X, Fansler MM, Janjoš U, Ule J, Mayr C. Cell. 5 August 2024. doi: 10.1016/j.cell.2024.07.015. 10.1016/j.cell.2024.07.015 PubMed 37961296