pCRISPR-PsppA-mCherry
(Plasmid #225428)

• Purpose: Plasmid encodes SgRNA, SpCas9 and homologous arms for homologous recombination of mCherry
• Depositing Lab: Geir Mathiesen
• Publication: Wiull et al Applied and Industrial Microbiology 2025

Backbone

• Vector backbone: pSIP401 (spp-based expression) derivative, lacks spp-genes for induction
• Backbone size w/o insert (bp): 3150
• Total vector size (bp): 6034
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: The plasmid can replicate in several lactic acid bacteria, as it contains rep256 from L. plantarum.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry, Cas9, SgRNA
• Species: E. coli
• Promoter: PsppA upstream of mCherry and Cas9, P3 upstream of SgRNA

Cloning Information

• Cloning method: Other
• 5′ sequencing primer: CTATTCAGGAATTGTCAGATAGGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry