Luciferase shRNA
(Plasmid
#225343)
-
PurposeshRNAmir backbone for RNA interference, with YFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 225343 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-CBA-miR-E
-
Vector typeMammalian Expression, AAV, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLuciferase shRNA
-
gRNA/shRNA sequencettaatcagagacttcaggcggt
-
SpeciesM. musculus (mouse)
-
Entrez GeneLOC116160065 (a.k.a. PPYR_00001, LUC1, PpyLuc1, luc, luciferase)
- Promoter CBA
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Luciferase shRNA was a gift from Huda Zoghbi (Addgene plasmid # 225343 ; http://n2t.net/addgene:225343 ; RRID:Addgene_225343) -
For your References section:
Evolutionarily conserved regulators of tau identify targets for new therapies. Kim J, de Haro M, Al-Ramahi I, Garaicoechea LL, Jeong HH, Sonn JY, Tadros B, Liu Z, Botas J, Zoghbi HY. Neuron. 2023 Mar 15;111(6):824-838.e7. doi: 10.1016/j.neuron.2022.12.012. Epub 2023 Jan 6. 10.1016/j.neuron.2022.12.012 PubMed 36610398