Skip to main content
Addgene

Luciferase shRNA
(Plasmid #225343)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225343 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-CBA-miR-E
  • Vector type
    Mammalian Expression, AAV, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Luciferase shRNA
  • gRNA/shRNA sequence
    ttaatcagagacttcaggcggt
  • Species
    M. musculus (mouse)
  • Entrez Gene
    LOC116160065 (a.k.a. PPYR_00001, LUC1, PpyLuc1, luc, luciferase)
  • Promoter CBA

Cloning Information

  • Cloning method Gibson Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Luciferase shRNA was a gift from Huda Zoghbi (Addgene plasmid # 225343 ; http://n2t.net/addgene:225343 ; RRID:Addgene_225343)
  • For your References section:

    Evolutionarily conserved regulators of tau identify targets for new therapies. Kim J, de Haro M, Al-Ramahi I, Garaicoechea LL, Jeong HH, Sonn JY, Tadros B, Liu Z, Botas J, Zoghbi HY. Neuron. 2023 Mar 15;111(6):824-838.e7. doi: 10.1016/j.neuron.2022.12.012. Epub 2023 Jan 6. 10.1016/j.neuron.2022.12.012 PubMed 36610398