Luciferase shRNA-TRE
(Plasmid #225339)

• Purpose: shRNAmir backbone under tet-operator for RNA interference, with YFP
• Depositing Lab: Huda Zoghbi
• Publication: Kim et al Neuron. 2023 Mar 15;111(6):824-838.e7. doi: 10.1016/j.neuron.2022.12.012. Epub 2023 Jan 6.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-TRE-miR-E
• Vector type: Mammalian Expression, AAV, RNAi

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Luciferase shRNA
• gRNA/shRNA sequence: ttaatcagagacttcaggcggt
• Species: M. musculus (mouse)
• Entrez Gene: LOC116160065 (a.k.a. PPYR_00001, LUC1, PpyLuc1, luc, luciferase)
• Promoter: TRE (tetracycline-responsive element)

Cloning Information

• Cloning method: Gibson Cloning

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry