Skip to main content
Addgene

RNF149 shRNA-TRE
(Plasmid #225337)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 225337 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-TRE-miR-E
  • Vector type
    Mammalian Expression, AAV, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RNF149 shRNA
  • gRNA/shRNA sequence
    TAAAGTTTTCAATACACACTGC
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Rnf149 (a.k.a. C76763, Greul4, Gm15832, AV037261, 1600023E10Rik, OTTMUSG00000026591)
  • Promoter TRE (tetracycline-responsive element)

Cloning Information

  • Cloning method Gibson Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RNF149 shRNA-TRE was a gift from Huda Zoghbi (Addgene plasmid # 225337 ; http://n2t.net/addgene:225337 ; RRID:Addgene_225337)
  • For your References section:

    Evolutionarily conserved regulators of tau identify targets for new therapies. Kim J, de Haro M, Al-Ramahi I, Garaicoechea LL, Jeong HH, Sonn JY, Tadros B, Liu Z, Botas J, Zoghbi HY. Neuron. 2023 Mar 15;111(6):824-838.e7. doi: 10.1016/j.neuron.2022.12.012. Epub 2023 Jan 6. 10.1016/j.neuron.2022.12.012 PubMed 36610398