RNF130 shRNA-TRE
(Plasmid
#225336)
-
PurposeshRNAmir backbone under tet-operator for RNA interference, with YFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 225336 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-TRE-miR-E
-
Vector typeMammalian Expression, AAV, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRNF130 shRNA
-
gRNA/shRNA sequenceTATTATTGTAGATGACTACAGC
-
SpeciesM. musculus (mouse)
-
Entrez GeneRnf130 (a.k.a. GP, G1rp, G1RZFP, GOLIATH, 2510042A13Rik)
- Promoter TRE (tetracycline-responsive element)
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RNF130 shRNA-TRE was a gift from Huda Zoghbi (Addgene plasmid # 225336 ; http://n2t.net/addgene:225336 ; RRID:Addgene_225336) -
For your References section:
Evolutionarily conserved regulators of tau identify targets for new therapies. Kim J, de Haro M, Al-Ramahi I, Garaicoechea LL, Jeong HH, Sonn JY, Tadros B, Liu Z, Botas J, Zoghbi HY. Neuron. 2023 Mar 15;111(6):824-838.e7. doi: 10.1016/j.neuron.2022.12.012. Epub 2023 Jan 6. 10.1016/j.neuron.2022.12.012 PubMed 36610398