pETcon-pGAL1-Aga2-Amyloid β42-c_myc
(Plasmid
#225223)
-
PurposeYeast optimized human Amyloid β42 fused with aga2 protein gene under gal1 promoter for the expression of Amyloid β42 in yeast surface display.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 225223 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepETcon(-)
- Backbone size w/o insert (bp) 5740
- Total vector size (bp) 6262
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameAmyloid β42
-
SpeciesH. sapiens (human)
-
Insert Size (bp)129
-
GenBank ID351
- Promoter GAL1
-
Tag
/ Fusion Protein
- c-myc Tag (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer AATATACCTCTATACTTTAACGTC
- 3′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameAga2
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)261
-
GenBank ID852851
-
Entrez GeneAGA2 (a.k.a. YGL032C)
- Promoter GAL1
-
Tag
/ Fusion Protein
- HA Tag (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer AATATACCTCTATACTTTAACGTC
- 3′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETcon-pGAL1-Aga2-Amyloid β42-c_myc was a gift from Urartu Seker (Addgene plasmid # 225223 ; http://n2t.net/addgene:225223 ; RRID:Addgene_225223) -
For your References section:
Synergistic Screening of Peptide-Based Biotechnological Drug Candidates for Neurodegenerative Diseases Using Yeast Display and Phage Display. Ozcelik CE, Begli O, Hincer A, Ahan RE, Kesici MS, Oguz O, Kasirga TS, Ozcubukcu S, Seker UOS. ACS Chem Neurosci. 2023 Oct 4;14(19):3609-3621. doi: 10.1021/acschemneuro.3c00248. Epub 2023 Aug 28. 10.1021/acschemneuro.3c00248 PubMed 37638647