MYC-hTRAK2
(Plasmid
#225142)
-
PurposeExpresses MYC-tagged human TRAK2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 225142 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV-Tag3A-myc
-
Backbone manufacturerAgilent Technologies
- Total vector size (bp) 7029
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTRAK2
-
Alt nameGRIF-1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2760
-
Entrez GeneTRAK2 (a.k.a. ALS2CR3, CALS-C, GRIF-1, GRIF1, MILT2, OIP98)
- Promoter CMV
-
Tag
/ Fusion Protein
- MYC (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGGCGGATCCAATGAGTCAATCCCAGAATGCA
- 3′ sequencing primer CCCCCTCGAGACTCAGTCCTCCTTCAGGACACC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPreviously published Schwarz lab plasmid.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: primers listed under 5' and 3' sequencing primers are those used to amplify TRAK2 with overhangs to do Gibson cloning.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MYC-hTRAK2 was a gift from Thomas Schwarz (Addgene plasmid # 225142 ; http://n2t.net/addgene:225142 ; RRID:Addgene_225142) -
For your References section:
Miro GTPase domains regulate the assembly of the mitochondrial motor-adaptor complex. Davis K, Basu H, Izquierdo-Villalba I, Shurberg E, Schwarz TL. Life Sci Alliance. 2022 Oct 27;6(1):e202201406. doi: 10.26508/lsa.202201406. Print 2023 Jan. 10.26508/lsa.202201406 PubMed 36302649