pRR5
(Plasmid
#225095)
-
Purpose(Empty Backbone) parental riboswitch reporter vector for regulation of the gfpUV fluorescent protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 225095 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBR322
- Backbone size (bp) 4000
-
Modifications to backboneinsertion of constitutive promoter and gfpUV reporter gene
-
Vector typeBacterial Expression, Synthetic Biology
- Promoter synthetic
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GCGCTAGCCACAGCTAACAC
- 3′ sequencing primer GTGTTGGCCATGGAACAGGTAGTTTTCCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRR5 was a gift from Robert Batey (Addgene plasmid # 225095 ; http://n2t.net/addgene:225095 ; RRID:Addgene_225095) -
For your References section:
Requirements for efficient ligand-gated co-transcriptional switching in designed variants of the B. subtilis pbuE adenine-responsive riboswitch in E. coli. Drogalis LK, Batey RT. PLoS One. 2020 Dec 1;15(12):e0243155. doi: 10.1371/journal.pone.0243155. eCollection 2020. 10.1371/journal.pone.0243155 PubMed 33259551