pSicoR (Puro) p65 shRNA1
(Plasmid #22507)

• Depositing Lab: Tyler Jacks
• Publication: Meylan et al Nature. 2009 Nov 5;462(7269):104-7. doi: 10.1038/nature08462. Epub 2009 Oct 21.

Backbone

• Vector backbone: pSicoR PGK puro
• Backbone manufacturer: Available at Addgene (#12084)
• Backbone size w/o insert (bp): 7700
• Vector type: Mammalian Expression, Lentiviral, RNAi, Cre/Lox
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: p65 shRNA1
• Alt name: p65
• Alt name: RelA
• Species: M. musculus (mouse)
• Entrez Gene: Rela (a.k.a. p65, p65 NF-kappa B, p65 NFkB)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: mU6-F

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Mouse p65 (RelA) shRNA1 in pSicoReverse (Puromycin)
forward oligo:
TGAATCCAGACCAACAATAATTCAAGAGATTATTGTTGGTCTGGATTCTTTTTTC
reverse oligo :
TCGAGAAAAAAGAATCCAGACCAACAATAATCTCTTGAATTATTGTTGGTCTGGATTCA