Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSicoR (Puro) p65 shRNA1
(Plasmid #22507)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 22507 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSicoR PGK puro
  • Backbone manufacturer
    Available at Addgene (#12084)
  • Backbone size w/o insert (bp) 7700
  • Vector type
    Mammalian Expression, Lentiviral, RNAi, Cre/Lox
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    p65 shRNA1
  • Alt name
    p65
  • Alt name
    RelA
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Rela (a.k.a. p65, p65 NF-kappa B, p65 NFkB)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mouse p65 (RelA) shRNA1 in pSicoReverse (Puromycin)
forward oligo:
TGAATCCAGACCAACAATAATTCAAGAGATTATTGTTGGTCTGGATTCTTTTTTC
reverse oligo :
TCGAGAAAAAAGAATCCAGACCAACAATAATCTCTTGAATTATTGTTGGTCTGGATTCA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSicoR (Puro) p65 shRNA1 was a gift from Tyler Jacks (Addgene plasmid # 22507 ; http://n2t.net/addgene:22507 ; RRID:Addgene_22507)
  • For your References section:

    Requirement for NF-kappaB signalling in a mouse model of lung adenocarcinoma. Meylan E, Dooley AL, Feldser DM, Shen L, Turk E, Ouyang C, Jacks T. Nature. 2009 Nov 5;462(7269):104-7. doi: 10.1038/nature08462. Epub 2009 Oct 21. 10.1038/nature08462 PubMed 19847165