Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSicoR (Puro) NEMO shRNA2
(Plasmid #22506)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 22506 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSicoR PGK puro
  • Backbone manufacturer
    Available at Addgene (#12084)
  • Backbone size w/o insert (bp) 7700
  • Vector type
    Mammalian Expression, Lentiviral, RNAi, Cre/Lox
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NEMO shRNA2
  • Alt name
    NEMO
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Ikbkg (a.k.a. 1110037D23Rik, IKK[g], NEMO)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mouse NEMO shRNA2 in pSicoReverse (Puromycin)
forward oligo:
TGGACAAGGCCTCTGTGAAATTCAAGAGATTTCACAGAGGCCTTGTCCTTTTTTC
reverse oligo :
TCGAGAAAAAAGGACAAGGCCTCTGTGAAATCTCTTGAATTTCACAGAGGCCTTGTCCA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSicoR (Puro) NEMO shRNA2 was a gift from Tyler Jacks (Addgene plasmid # 22506 ; http://n2t.net/addgene:22506 ; RRID:Addgene_22506)
  • For your References section:

    Requirement for NF-kappaB signalling in a mouse model of lung adenocarcinoma. Meylan E, Dooley AL, Feldser DM, Shen L, Turk E, Ouyang C, Jacks T. Nature. 2009 Nov 5;462(7269):104-7. doi: 10.1038/nature08462. Epub 2009 Oct 21. 10.1038/nature08462 PubMed 19847165