pET11a-AldoA
(Plasmid
#224925)
-
PurposeInducible expression of human aldolase A
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 224925 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET11a
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5641
- Total vector size (bp) 6733
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAldolase A
-
Alt nameFructose-bisphosphate aldolase A
-
Alt nameAldoA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1092
-
Entrez GeneALDOA (a.k.a. ALDA, GSD12, HEL-S-87p)
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET11a-AldoA was a gift from Liskin Swint-Kruse (Addgene plasmid # 224925 ; http://n2t.net/addgene:224925 ; RRID:Addgene_224925) -
For your References section:
Substitutions at a rheostat position in human aldolase A cause a shift in the conformational population. Fenton KD, Meneely KM, Wu T, Martin TA, Swint-Kruse L, Fenton AW, Lamb AL. Protein Sci. 2022 Feb;31(2):357-370. doi: 10.1002/pro.4222. Epub 2021 Nov 12. 10.1002/pro.4222 PubMed 34734672