Skip to main content
Addgene

pYAMTr2GCsgSeLEU2
(Plasmid #224870)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 224870 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pYAMTr2GCas
  • Vector type
    Yeast Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    pYAMTr2GC having the guide sequence SeLEU2
  • gRNA/shRNA sequence
    AAGGACCAGATAGGTAATGG
  • Species
    S. cerevisiae (budding yeast)
  • Entrez Gene
    DI49_0736 (a.k.a. DI49_0736)

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The CRISPR/Cas9 system component genes came from pML104 (addgene plasmid #67638, Laughery et. 2015).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYAMTr2GCsgSeLEU2 was a gift from Katsunori Suzuki (Addgene plasmid # 224870 ; http://n2t.net/addgene:224870 ; RRID:Addgene_224870)
  • For your References section:

    Conversion of polyploid and alloploid Saccharomyces sensu stricto strains to leu2 mutants by genome DNA editing. Kiyokawa K, Sakuma T, Moriguchi K, Sugiyama M, Akao T, Yamamoto T, Suzuki K. Appl Microbiol Biotechnol. 2024 Jul 12;108(1):416. doi: 10.1007/s00253-024-13242-y. 10.1007/s00253-024-13242-y PubMed 38995331