pYAMTr2GCsgScLEU2
(Plasmid
#224868)
-
PurposeDisruption of S. cerevisiae type LEU2 gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 224868 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepYAMTr2GCas
-
Vector typeYeast Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namepYAMTr2GC having the guide sequence ScLEU2
-
gRNA/shRNA sequenceAAGGACCAAATAGGCAATGG
-
SpeciesS. cerevisiae (budding yeast)
-
Entrez GeneLEU2 (a.k.a. YCL018W)
Cloning Information
- Cloning method Other
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe CRISPR/Cas9 system component genes came from pML104 (addgene plasmid #67638, Laughery et. 2015).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYAMTr2GCsgScLEU2 was a gift from Katsunori Suzuki (Addgene plasmid # 224868 ; http://n2t.net/addgene:224868 ; RRID:Addgene_224868) -
For your References section:
Conversion of polyploid and alloploid Saccharomyces sensu stricto strains to leu2 mutants by genome DNA editing. Kiyokawa K, Sakuma T, Moriguchi K, Sugiyama M, Akao T, Yamamoto T, Suzuki K. Appl Microbiol Biotechnol. 2024 Jul 12;108(1):416. doi: 10.1007/s00253-024-13242-y. 10.1007/s00253-024-13242-y PubMed 38995331