pUt-MONARCH 2.0_crEGFP
(Plasmid
#224793)
-
PurposeLPUtopia matching RMCE donor plasmid with MONARCH 2.0 circuit with crRNA targeting EGFP.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 224793 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUt-mNF-Cas13d
-
Backbone manufacturerBalazsi Lab
- Backbone size w/o insert (bp) 11752
- Total vector size (bp) 12000
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namecrEGFP
-
SpeciesSynthetic
- Promoter CMV-d2i
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer taagaattcgattcgtcagtagg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTriplex stablier
-
SpeciesSynthetic
-
Insert Size (bp)110
- Promoter CMV-d2i
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer taagaattcgattcgtcagtagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.05.11.593702 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUt-MONARCH 2.0_crEGFP was a gift from Gabor Balazsi (Addgene plasmid # 224793 ; http://n2t.net/addgene:224793 ; RRID:Addgene_224793) -
For your References section:
Optimizing a CRISPR-Cas13d Gene Circuit for Tunable Target RNA Downregulation with Minimal Collateral RNA Cutting. Wan Y, Helenek C, Coraci D, Balazsi G. ACS Synth Biol. 2024 Oct 18;13(10):3212-3230. doi: 10.1021/acssynbio.4c00271. Epub 2024 Oct 8. 10.1021/acssynbio.4c00271 PubMed 39377757