LPUtopia-8
(Plasmid
#224781)
-
PurposeLanding Pad donor vector for AAVS1 site integration in human and VeroE6 cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 224781 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLPUtopia-7
-
Backbone manufacturerBalazsi Lab
- Backbone size w/o insert (bp) 6823
- Total vector size (bp) 8916
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namepuromycin N-acetyltransferase
-
Alt namePuroR
-
SpeciesSynthetic
-
Insert Size (bp)600
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGaccgagtacaagcccac (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameenhanced Green Fluorescence Protein
-
Alt nameEGFP
-
SpeciesSynthetic
-
Insert Size (bp)719
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer taagggcgaattctgcagat (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameRed Fluorescence Protein
-
Alt nameRFP
-
SpeciesSynthetic
-
Insert Size (bp)699
- Promoter CMV
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer ctgccaagtaggaaagtccc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There are some discrepancies between Addgene's sequence and the depositor-provided reference, however the depositor has confirmed these changes do not affect plasmid function.
Please visit https://doi.org/10.1101/2024.05.11.593702 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LPUtopia-8 was a gift from Gabor Balazsi (Addgene plasmid # 224781 ; http://n2t.net/addgene:224781 ; RRID:Addgene_224781) -
For your References section:
Optimizing a CRISPR-Cas13d Gene Circuit for Tunable Target RNA Downregulation with Minimal Collateral RNA Cutting. Wan Y, Helenek C, Coraci D, Balazsi G. ACS Synth Biol. 2024 Oct 18;13(10):3212-3230. doi: 10.1021/acssynbio.4c00271. Epub 2024 Oct 8. 10.1021/acssynbio.4c00271 PubMed 39377757