pIRES2-eGFP:HA-mTREK-1(tandem S131C-S131C)
(Plasmid
#224779)
-
PurposeMammalian expression vector for generating a tandem mTREK-1 with two identical monomers linked through a 20 AA flexible linker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 224779 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepIRES2-eGFP
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTandem TREK-1 S131C-S131C)
-
Alt nameKcnk2
-
Alt nameTREK-1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2556
-
MutationS131C / S562C
-
Entrez GeneKcnk2 (a.k.a. A430027H14Rik, TREK-1)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIRES2-eGFP:HA-mTREK-1(tandem S131C-S131C) was a gift from Dan Minor (Addgene plasmid # 224779 ; http://n2t.net/addgene:224779 ; RRID:Addgene_224779) -
For your References section:
Development of covalent chemogenetic K(2P) channel activators. Deal PE, Lee H, Mondal A, Lolicato M, Mendonca PRF, Black H, Jang S, El-Hilali X, Bryant C, Isacoff EY, Renslo AR, Minor DL Jr. Cell Chem Biol. 2024 Jul 18;31(7):1305-1323.e9. doi: 10.1016/j.chembiol.2024.06.006. 10.1016/j.chembiol.2024.06.006 PubMed 39029456