pGEMHE:mTREK-1(S131C/A286F)
(Plasmid
#224748)
-
PurposeIn vitro transcription for Oocyte expression of mTREK-1(S131C/A286F)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 224748 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEMHE
-
Vector typeIn vitro transcription for Oocyte expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePotassium channel subfamily K member 2
-
Alt nameKcnk2
-
Alt nameTREK-1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1236
-
MutationS131C / A286F
-
Entrez GeneKcnk2 (a.k.a. A430027H14Rik, TREK-1)
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind III (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TCGGGTGTTCTTGAGGCTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEMHE:mTREK-1(S131C/A286F) was a gift from Dan Minor (Addgene plasmid # 224748 ; http://n2t.net/addgene:224748 ; RRID:Addgene_224748) -
For your References section:
Development of covalent chemogenetic K(2P) channel activators. Deal PE, Lee H, Mondal A, Lolicato M, Mendonca PRF, Black H, Jang S, El-Hilali X, Bryant C, Isacoff EY, Renslo AR, Minor DL Jr. Cell Chem Biol. 2024 Jul 18;31(7):1305-1323.e9. doi: 10.1016/j.chembiol.2024.06.006. 10.1016/j.chembiol.2024.06.006 PubMed 39029456