FAM177A1-SNAP
(Plasmid
#224592)
-
PurposeFor expression of FAM177A1-SNAPTag in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 224592 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFAM177A1
-
SpeciesH. sapiens (human)
-
Entrez GeneFAM177A1 (a.k.a. C14orf24)
- Promoter CMV
-
Tag
/ Fusion Protein
- SNAP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCloned from Genscript FAM177A1-FLAG
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.12.18.572081 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FAM177A1-SNAP was a gift from Pietro De Camilli (Addgene plasmid # 224592 ; http://n2t.net/addgene:224592 ; RRID:Addgene_224592) -
For your References section:
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1. Ugur B, Schueder F, Shin J, Hanna MG, Wu Y, Leonzino M, Su M, McAdow AR, Wilson C, Postlethwait J, Solnica-Krezel L, Bewersdorf J, De Camilli P. bioRxiv [Preprint]. 2023 Dec 18:2023.12.18.572081. doi: 10.1101/2023.12.18.572081. 10.1101/2023.12.18.572081 PubMed 38187698