pCAG-memRFP-3xPax7gRNA
(Plasmid
#224569)
-
PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and membrane RFP reporter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 224569 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAG-memRFP
-
Modifications to backboneGuide RNAs inserted following memRFP
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemRFP1
-
Alt namemonomeric red fluorescent protein
-
gRNA/shRNA sequencePax7 gRNA1: aacccctaccaactggtcggggtttgaaacccgaatttgatgcgtagcacacg; Pax7 gRNA2: aacccctaccaactggtcggggtttgaaacccctttgtcgcccaggatgccat; Pax7 gRNA3: aacccctaccaactggtcggggtttgaaacattcatgtggttggcaggagctg
-
SpeciesSynthetic; Discosoma sp.
-
MutationCodon optimized
-
GenBank IDAF506027.1
-
Tag
/ Fusion Protein
- Membrane localization signal
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer tacagctcctgggcaacgtg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-memRFP-3xPax7gRNA was a gift from Erica Hutchins (Addgene plasmid # 224569 ; http://n2t.net/addgene:224569 ; RRID:Addgene_224569) -
For your References section:
CRISPR-Cas13d as a molecular tool to achieve targeted gene expression knockdown in chick embryos. Kim M, Hutchins EJ. Dev Biol. 2024 Nov 30:S0012-1606(24)00265-3. doi: 10.1016/j.ydbio.2024.11.013. 10.1016/j.ydbio.2024.11.013 PubMed 39622311