pFastBacI-KDAC8 D101E
(Plasmid #224350)

• Purpose: Expresses human KDAC8 (HDAC8) D101E in insect cells
• Depositing Lab: Terry Watt
• Publication: Toro et al Biochemistry. 2021 Aug 24;60(33):2524-2536. doi: 10.1021/acs.biochem.1c00384. Epub 2021 Aug 6.

Backbone

• Vector backbone: pFastBacI
• Backbone manufacturer: Thermo Fisher Scientific
• Backbone size w/o insert (bp): 4682
• Total vector size (bp): 5855
• Modifications to backbone: Removal of one NheI site
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KDAC8
• Alt name: HDAC8
• Species: H. sapiens (human)
• Insert Size (bp): 1173
• Mutation: Aspartate 101 mutated to glutamate
• Entrez Gene: HDAC8 (a.k.a. CDA07, CDLS5, HD8, HDACL1, KDAC8, MRXS6, RPD3, WTS)
• Promoter: Polyhedrin
• Tag / Fusion Protein:
  • TEV-cleavable His6 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CTAGTGGTTGGCTACGTATACTC
• 3′ sequencing primer: CCTCTACAAATGTGGTATGGCTG

Resource Information

• Supplemental Documents:
  • pFastBac KDAC8 (HDAC8) D101E.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

Codon optimized for bacterial expression but expresses well in HighFive insect cells.