Skip to main content
Addgene

pFastBacI-KDAC8 H143A
(Plasmid #224344)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 224344 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pFastBacI
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 4682
  • Total vector size (bp) 5855
  • Modifications to backbone
    Removal of one NheI site
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KDAC8
  • Alt name
    HDAC8
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1173
  • Mutation
    Histidine 143 mutated to alanine
  • Entrez Gene
    HDAC8 (a.k.a. CDA07, CDLS5, HD8, HDACL1, KDAC8, MRXS6, RPD3, WTS)
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • TEV-cleavable His6 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CTAGTGGTTGGCTACGTATACTC
  • 3′ sequencing primer CCTCTACAAATGTGGTATGGCTG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Codon optimized for bacterial expression but expresses well in HighFive insect cells. The resulting protein is catalytically inactive.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFastBacI-KDAC8 H143A was a gift from Terry Watt (Addgene plasmid # 224344 ; http://n2t.net/addgene:224344 ; RRID:Addgene_224344)

  • For your References section:

    Purification of metal-dependent lysine deacetylases with consistently high activity. Toro TB, Painter RG, Haynes RA, Glotser EY, Bratton MR, Bryant JR, Nichols KA, Matthew-Onabanjo AN, Matthew AN, Bratcher DR, Perry CD, Watt TJ. Protein Expr Purif. 2018 Jan;141:1-6. doi: 10.1016/j.pep.2017.08.009. Epub 2017 Aug 24. 10.1016/j.pep.2017.08.009 PubMed 28843507
Related items: