Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGL2 enhancer- F3 GATA mut
(Plasmid #22430)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 22430 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGL2 Enhancer
  • Backbone size w/o insert (bp) 5854
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    F3 GATA mut
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1055
  • GenBank ID
    HSU24214
  • Entrez Gene
    NOS3 (a.k.a. ECNOS, eNOS)
  • Tag / Fusion Protein
    • luciferase reporter gene (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer see article
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

GATA mutation oligo - GCTCCCACTTTAGAGCCTCAGT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL2 enhancer- F3 GATA mut was a gift from William Sessa (Addgene plasmid # 22430 ; http://n2t.net/addgene:22430 ; RRID:Addgene_22430)
  • For your References section:

    Functional analysis of the human endothelial nitric oxide synthase promoter. Sp1 and GATA factors are necessary for basal transcription in endothelial cells. Zhang R, Min W, Sessa WC. J Biol Chem. 1995 Jun 23. 270(25):15320-6. 10.1074/jbc.270.25.15320 PubMed 7541039