U6-PGK-hCD2
(Plasmid
#224294)
-
PurposeExpresses sgRNA from U6 promoter and human CD2 under PGK
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 224294 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneMSCV
-
Vector typeMammalian Expression, Retroviral, CRISPR
-
Selectable markersCD2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameU6 sgRNA cassette with CD2 under PGK promoter
-
gRNA/shRNA sequenceempty
-
SpeciesH. sapiens (human)
-
Entrez GeneCD2 (a.k.a. LFA-2, SRBC, T11)
- Promoter U6/PGK
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtggaaaggacgaaacaccggg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
U6-PGK-hCD2 was a gift from Nikhil Joshi (Addgene plasmid # 224294 ; http://n2t.net/addgene:224294 ; RRID:Addgene_224294) -
For your References section:
KLF2 maintains lineage fidelity and suppresses CD8 T cell exhaustion during acute LCMV infection. Fagerberg E, Attanasio J, Dien C, Singh J, Kessler EA, Abdullah L, Shen J, Hunt BG, Connolly KA, De Brouwer E, He J, Iyer NR, Buck J, Borr ER, Damo M, Foster GG, Giles JR, Huang YH, Tsang JS, Krishnaswamy S, Cui W, Joshi NS. Science. 2025 Jan 2;387(6735):eadn2337. doi: 10.1126/science.adn2337. Epub 2025 Feb 14. 10.1126/science.adn2337 PubMed 39946463