pGEX6p1_RBFOX2_RRM
(Plasmid
#224293)
-
PurposeGST-RBFOX2(RRM domain) purification from bacteria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 224293 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEX6P1
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRNA binding fox-1 homolog 2 RNA-recognition motif
-
Alt nameRBFOX2 RRM domain
-
SpeciesH. sapiens (human)
-
Insert Size (bp)282
-
Mutationaa 74-167
-
Entrez GeneRBFOX2 (a.k.a. FOX2, Fox-2, HNRBP2, HRNBP2, RBM9, RTA, dJ106I20.3, fxh)
- Promoter tac promoter
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX6p1_RBFOX2_RRM was a gift from Chuan He (Addgene plasmid # 224293 ; http://n2t.net/addgene:224293 ; RRID:Addgene_224293) -
For your References section:
RBFOX2 recognizes N(6)-methyladenosine to suppress transcription and block myeloid leukaemia differentiation. Dou X, Xiao Y, Shen C, Wang K, Wu T, Liu C, Li Y, Yu X, Liu J, Dai Q, Pajdzik K, Ye C, Ge R, Gao B, Yu J, Sun S, Chen M, Chen J, He C. Nat Cell Biol. 2023 Sep;25(9):1359-1368. doi: 10.1038/s41556-023-01213-w. Epub 2023 Aug 28. 10.1038/s41556-023-01213-w PubMed 37640841